• Question: how do you get and store a genetic code of two and how do you let them grow Looking forwould to read your answer

    Asked by husseinbaker to Davie, Gemma, James P, James V, Nuala on 27 Jun 2012.
    • Photo: James Pope

      James Pope answered on 27 Jun 2012:

      Hi husseinbaker,

      I’m not entirely sure I’m afraid, I know it comes from making notes on the DNA and the combinations of A, T, G & C letters (which represent proteins) in each chromosome pairing in every genome (humans have 23 pairs of Chromosomes). But I’m not certain how they do it!

    • Photo: James Verdon

      James Verdon answered on 28 Jun 2012:

      Hi hussein,

      DNA consists of 4 chemical bases, called A, T, C and G. The DNA is basically a long list of one after the other, so AGCTGAGTCGTAGTCGAGGTTTTAACA but for millions of letters. I’m not exactly sure how the sequencing works, but it involves using different chemicals that split up the chain at different points. For example, if you use a chemical that splits the chain where there is a T, then wherever there’s a split that’s where a T is. But I think it’s actually a lot more complicated than that.

      Now to get it to grow: Lets say you’ve taken some DNA and modified it in the lab. Maybe you’ve changed some of the genes – maybe removing a gene that could have caused a disease in an animal. To grow an animal from the DNA, you take an egg cell of the right animal (so a cow egg if you’re working with cow DNA, sheep egg for sheep, etc). You remove the DNA that is already inside the cell. Then, you insert the modified DNA that you have created. The new DNA will program the cell to being growing into the animal.

      At least, I think that’s the basics of how it works. This isn’t our area of expertise, because we mainly study the earth, I’ve never done much biology. There’s a GM food section on this site at the moment: https://gmfood.iasuk.ddev.site/ Those guys will probably have a much better answer for you.

Comments